Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0002908 | |||
Gene | PTK2 | Organism | Human |
Genome Locus | chr8:141840570-141874498:- | Build | hg19 |
Disease | Pulmonary Tuberculosis | ICD-10 | Respiratory tuberculosis, bacteriologically and histologically confirmed (A15) |
DBLink | Link to database | PMID | 29248507 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | Two subjects with Active Pulmonary Tuberculosis (APTB) and two age- and gender-matched healthy controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GGGGCAATGCACTAGAAAAG ReverseTCCTTTTGGCAAATAACGAAT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Qian, Z, Liu, H, Li, M, Shi, J, Li, N, Zhang, Y, Zhang, X, Lv, J, Xie, X, Bai, Y, Ge, Q, Ko, EA, Tang, H, Wang, T, Wang, X, Wang, Z, Zhou, T, Gu, W (2018). Potential Diagnostic Power of Blood Circular RNA Expression in Active Pulmonary Tuberculosis. EBioMedicine, 27:18-26. |